Help - Search - Members - Calendar
Full Version: A Pack of Blacks Beat Lone White Kid Forums > GTA4.TV/ Archive > Old Forum Archive (Read Only) > General > Political & World Issues
Pages: 1, 2
Mister Triangle
Check this out

Make sure you check out the FBI stats at the bottom.
Don't walk near a gang then? It's not a rare attack to happen.

In the UK about 5 years ago there was a famous case where a black guy got stabbed to death for no reason by a 'pack' of whites.
Thats exactly his point.
The case where the white guys beat up a black guy, while the case of this white guy getting beat by blacks is receiving very little media at all.

This event is like nothing compared to someone being stabbed to death.

Wow, he got smashed in? this happens every fucking day! It's nothing big at all.
This kid barely even got hurt, this shouldn't even be in the news.

Max, the local newspaper section where it shows the crimes in the area.
This doesn't surprise me one bit dry.gif

Whats more is that they didn't really hurt him.........XD.png
QUOTE(LattO @ Mar 21 2008, 04:57 PM) [snapback]1400762[/snapback]
This kid barely even got hurt, this shouldn't even be in the news.

Max, the local newspaper section where it shows the crimes in the area.

What about awful attacks on people like Kriss Donald, it recieved very little media attention, despite been killed for been White by 5 Asians, yet compare with the Stephen Lawrence case, which was in the media for years, and you see the difference in reporting. I can use countless different examples which show this to be the case.
I've walked by gangs of blacks and whites numerous times.

If you make eye contact, smile and nod your head.
If they look like they're going to cause trouble, put your hand in your inside jacket pocket to make it look like you're carrying.

A simple street-smart philosophy to live by.
Mister Triangle
I don't understand the logic here other than liberal idiotic logic. Whites attacking blacks is a very small and I mean very small percentage of hate crimes. It hardly ever happens. It's mostly blacks attacking whites just like you see here except most cases are very brutal compared to this one. This guy was lucky. It wasn't a gang either. They all run in packs like that because they can't handle a white man 1 on 1. It's always 4 or 5 on 1. It's in epidemic proportions in America. Just look on YouTube. Blacks have made entertainment out of it. If you're white & this vid don't piss you off then I feel sorry for you. I guess that it was how you were raised.

Samurai tbag, You're a prime example of whats happened in the UK. You should be ashamed but i know you're not nor will you ever be. The UK has slipped in the wrong direction and everybody knows it and I feel sorry for the normal peeps that live over there. That place needs a revolution just about as bad as the U.S. does.
Mister triangle, you just made yourself look like a complete idiot.

The best fighters in the world are Black, and i could bet alot of money that they've taken on many Whites, Asians, and Hispanics one on one, and probably won.

QUOTE(LattO @ Mar 21 2008, 08:23 PM) [snapback]1400822[/snapback]
Mister triangle, you just made yourself look like a complete idiot.

The best fighters in the world are Black, and i could bet alot of money that they've taken on many Whites, Asians, and Hispanics one on one, and probably won.

One on One, blacks can be very good fighters, however many of them(Same with some Whites too) attack in packs, even if they stood a decent chance one on one with the guy they are attacking.
Anyone would attack in a group just because it's easier to win.
That's common sense, i could kill a deer easily, but i go in hunting groups just because.

Attacking in groups has nothing to do with race, just smarts.
Or lack of nobility. Integrity. Guts. Etc... I've been jumped a couple times--you get fucked up and you can't really get an edge over anyone.
Mister Triangle
Yeah. mmmhmm. You don't see too many UFC or other orginisation fighters. Why is that? 'Cause them white boys smack'em around like the little bitches they are. 1 might make it through every now & then but they always get put in their place. You hero worshippers are funny, though. Quite pathetic, really.
His point is that when a white is ganked (jumped) by a group of blacks or arabs just becasue he is white nobody cares because it doesn't make good news. When a whites harm blacks for being black (rare as it is) the media makes a huge deal out of it because it's easier to make a sappy story out of.

Did you know when blacks or asians kill or beat whites only because they are white the police don't even consider it a racial/hate crime. Please.
QUOTE(Skinny. @ Mar 22 2008, 03:18 AM) [snapback]1400913[/snapback]
His point is that when a white is ganked (jumped) by a group of blacks or arabs just becasue he is white nobody cares because it doesn't make good news. When a whites harm blacks for being black (rare as it is) the media makes a huge deal out of it because it's easier to make a sappy story out of.

Did you know when blacks or asians kill or beat whites only because they are white the police don't even consider it a racial/hate crime. Please.

I know where he is coming from but still, not fights ever really make the news.. it's stupid, i could walk 3 blocks and see someone getting jumped right now.

and where are you police facts coming from?

QUOTE(Mister Triangle)
Yeah. mmmhmm. You don't see too many UFC or other orginisation fighters. Why is that? 'Cause them white boys smack'em around like the little bitches they are. 1 might make it through every now & then but they always get put in their place. You hero worshippers are funny, though. Quite pathetic, really.

In no way am i trying to make this like a race war(i'm black and white, so i kind of have two points of views), but colored people are taking overs sports in all varieties.

In the UFC and Pride almost all weightclasses are being taken over by a colored person (mostly being black/hispanc)- Quinton Jackson, Anderson Silva, even fucking Kimbo is taking over.

And not even looking at that, there is no one "best" race.
For every best one out there, there is someone else who is atleast one step above them.

And i don't know where this whole "white boys smack'em around like bitches" is coming from.
Cause all races at like bitches..You seem like a very angry person at blacks.. and it's kind of funny. rolleyes.gif
Mister Triangle
Thanks for making my point Skinny. Latto, what makes me mad is that over 34,000 white women were raped by black men last year in the U.S.. When blacks gang a white kid it is not a hate crime. When whites strike back their ass is going to prison for a very long time for a hate crime. The vast majority of hate crimes is black on white violence and it's getting worse at staggering rates according to The U.S. Dept. Of Justice.

I was just seeing what the point of view is here like I do at a lot of other forums and shockingly the results are the same. I'm just gathering stats you could say. There is an attack on whites in America not only by negros but mexicans & other foreigners aswell. but yet whites are not defending themselves and I can't figure that out nor can I figure out why it makes no one mad. Again, I'm not a hardcore racist 'cause I give everybody a chance. If they act right & talk right then fine.

Minorities are trying to take what whites have built and in a lot of cases they're trying to take credit for inventions too! For example; negros are trying to claim that they invented the stop light when in reality the patent office(government website) clearly states different. Just google 'black invention myths' and you'll see what I'm saying. I'd really hate to see America get taken over by a non-white group for many reasons that are legitimate. Statistics aren't racist. They are the truth of what is.

In south Africa blacks surprise sex & murder every white on sight & take pride in it. They raped & murdered all the farmers & moved into their farms. Now, they're begging white farmers that escaped with there life to come back because they are too lazy to do the farming and all of them are starving to death. I find that funny. Some scientist say that there is proof now that whites were the first in Africa. It's estimated by governments that Africa is now over 90% infested with aids. We can't afford to let America slip back a thousand years and crumble to the ground like Rome did. Wake up!
You really don't make much sense mate. Why does it matter if the crime makes the news? The media is an industry, everything you read, see and hear is there for money. The crime itself will still be dealt with in the same manor whether or not its in the media.

Did you take into account that the crimes aren't race related? Most gang fights are to do with alcohol, drugs and respect, not race or ethnicity.

You're just trying to start a race war and in doing so, you're over looking the logical answer.

QUOTE(Mister Triangle @ Mar 21 2008, 07:41 PM) [snapback]1400812[/snapback]
Samurai tbag, You're a prime example of whats happened in the UK. You should be ashamed but i know you're not nor will you ever be. The UK has slipped in the wrong direction and everybody knows it and I feel sorry for the normal peeps that live over there. That place needs a revolution just about as bad as the U.S. does.

The 'wrong' way? That's comming from someone whos country is in an economic recession.

I hope you realise the £GBP is the strongest currency in the world. Meanwhile, the $USD just keeps falling.

However, if you're thinking socialy. If you think it's wrong that everybody should be entitled to free healthcare and support, then you're a cold person.

Ironically, with some of the shit you come out with, I'd have though you'd have been an extreme Christian, but clearly not.

You have to realise that old biggoted racists from the south are all washed up, you're going to have to deal with it mate. Period.
QUOTE(Mister Triangle @ Mar 22 2008, 11:36 AM) [snapback]1400973[/snapback]

You honestly rambled on about nothing important.

If you want to bring back stats and i'm not going to waste my time looking up bullshit, but not too long ago whites were raping and slaughtering every black on site.

Stats don't mean shit.

What do inventions have to do with this whole argument?
What does whites being first in africa have to do with this argument?

You're rambling on to make the "white" race sound superior to all.

And point blank, you're making yourself seem more and more of a dumbass.

new major on the block
QUOTE(LattO @ Mar 21 2008, 08:23 PM) [snapback]1400822[/snapback]
Mister triangle, you just made yourself look like a complete idiot.

The best fighters in the world are Black, and i could bet alot of money that they've taken on many Whites, Asians, and Hispanics one on one, and probably won.

I'm sorry but I'll take a well trained asian in martial arts over any black, white or hispanic any day.
Mister Triangle
QUOTE(LattO @ Mar 22 2008, 05:59 PM) [snapback]1401025[/snapback]
QUOTE(Mister Triangle @ Mar 22 2008, 11:36 AM) [snapback]1400973[/snapback]

You honestly rambled on about nothing important.

If you want to bring back stats and i'm not going to waste my time looking up bullshit, but not too long ago whites were raping and slaughtering every black on site.

Stats don't mean shit.

What do inventions have to do with this whole argument?
What does whites being first in africa have to do with this argument?

You're rambling on to make the "white" race sound superior to all.

And point blank, you're making yourself seem more and more of a dumbass.

Liberals don't like to hear stats. Especially ones with direct links to gov. websites. Whites NEVER raped or murdered in the numbers that negros are now. Negros have murdered more people than all the people killed in all wars combined. Don't you get it!? Or are you just a dumbboy? It's funny how when someone points out the black problem, they automatically become a "dumbass' or 'inbred rednecks'.

Samurai Tbag, Your so-called free healthcare is a flawed joke at best. Crimes ARE race related. Did you check the link that I provided to The U.S. Dept. Of Justice????? Jesus H. Christ! It's not gangs, it's negros! You should educate yourself a little more. I'm not trying to start a race war. That will happen the next time blacks riot. We will see a race war in our lifetime and it won't be pretty. War never is.

Did you know that when the blacks savagely gang beat the innocent whites in Jena and the busloads of blacks were pouring in so they could start looting, raping, and murdering that whites from all over the U.S. was surrounding Jena. The hotels were packed. Me & 12 others from where I live took our vacations & drove out & stayed a week waiting. That's the only reason that I know. The media never said shit about it because they knew that it was a hair trigger and word got back to Al Sharpton & Jesse Jackson and they went around in a hush tone telling the masses to not even think about it. The black panthers sent out scouts that were being watched every inch that they covered and they knew it! They came right by our hotel and looked quite nervous when they seen the parking lot was more than full with mad white mf'ers. Shit was about to get deep and not too many even know how close it came. I think thats amazing that it has been kept on the down low but the media can do that.

The hotel that I was in didn't have a room left. People were in the parking lots and I couldn't figure out why until I went around & started talking and I was greatful that there were so many that thinks enough of the white race to show up and lend support. It was a scary moment and you'll hardly ever hear me say that. As far as America heading for recession, you're correct. There's no denying that. You know why? Because of filthy, greedy jews in New York.

They're in a greed feeding frenzy and it will cause a depression and then shits gonna get ugly. The trash will be taken out in America and we will have to start anew. Times are gonna get tough. Hell, they already are. Gas right now is $3.49 a gallon where I live and gauranteed to hit $4.00 by the end of spring and groceries are unbelievable too. Diesel is $4.09 so truckers will be striking soon and the country will stop. We'll have to go back to the old way of living by hunting and living off the land. People in the cities will starve to death & die because they have no common sense or idea how to survive. I'm glad I hunt & fish and can everything. I have enough for atleast 2 years in my cellar.
Your slippery slope is hilarious... we won't be going back to nomadic lifestyles--we'll simply see lots of bad stories containing peoples that simple could not afford to commute to work to live and support their family. That is, if it ever becomes that bad, which I hope it won't.
QUOTE(Mister Triangle @ Mar 23 2008, 03:22 AM) [snapback]1401079[/snapback]
Samurai Tbag, Your so-called free healthcare is a flawed joke at best. Crimes ARE race related.

Er, how do you explain accidents? Or, you think the guy dying of cancer has been attacked? Lol. Oh dear, someone help this guy.

QUOTE(Mister Triangle @ Mar 23 2008, 03:22 AM) [snapback]1401079[/snapback]
As far as America heading for recession, you're correct. There's no denying that. You know why? Because of filthy, greedy jews in New York.

The jews in New York are nothing to do with it. It's to do with poor management from Cheney's White House. If anything, rich 'jews' are keeping whats left of the economy running.
The difference is, that white people expect this sort of mindless violence from black people, and on the other hand white people don't expect this sort of mindless violence from white people.
QUOTE(Qdeathstar @ Mar 23 2008, 02:52 PM) [snapback]1401155[/snapback]
The difference is, that white people expect this sort of mindless violence from black people, and on the other hand white people don't expect this sort of mindless violence from white people.

No the difference is you are all racist for putting them into groups, the whole idea of race was made by racists, I know none of you have a clue how different blacks and whites actually are so lets some it up with some real data.

All humans are very similar genetically. There are more differences within a ďraceĒ than between ďracesĒ.

8/10th diversity = differences between people
of the same country.
1/10th diversity = differences between nations.
1/10th diversity = differences between ďracesĒ.

So all you ignorant bigots can really just go fuck yourself unless of course you have some better data. (going to love to see this)
The Whole idea of Race is not a concept of Racists, you have to aknoledge there is a difference between different Races, and of course subdivisons in different races.

For example, Whites and Blacks have different cultures and languages, aswell as physical charachteristics such as skull size, facial differences, body shape among other things. Also though, Whites can be split up into Alpine and Nordic subdivisons, Nordics have longer skull shapes, lighter hair and taller bodies, while Alpines have shorter more solid bodies, rounder skulls and tend to have darker hair. However, these people are united (Perhaps vaguely but nevertheless united) through similar cultures, languages ect. This can be observed by many words been similar through the different subdiviosions different areas(For example, use the word father, English=Father, German=Vater, Latin=Frater, Greek=Brahter, Russian=Batya.), while through different races it is completely different.

Sorry if I explained my self a little badly.
QUOTE(BIG FUCKING SPIDER @ Mar 23 2008, 08:50 PM) [snapback]1401203[/snapback]
The Whole idea of Race is not a concept of Racists, you have to aknoledge there is a difference between different Races, and of course subdivisons in different races.

For example, Whites and Blacks have different cultures and languages, aswell as physical charachteristics such as skull size, facial differences, body shape among other things. Also though, Whites can be split up into Alpine and Nordic subdivisons, Nordics have longer skull shapes, lighter hair and taller bodies, while Alpines have shorter more solid bodies, rounder skulls and tend to have darker hair. However, these people are united (Perhaps vaguely but nevertheless united) through similar cultures, languages ect. This can be observed by many words been similar through the different subdiviosions different areas(For example, use the word father, English=Father, German=Vater, Latin=Frater, Greek=Brahter, Russian=Batya.), while through different races it is completely different.

Sorry if I explained my self a little badly.

I don't quite see what that has to do with the issue at hand.

QUOTE(BIG FUCKING SPIDER @ Mar 23 2008, 08:50 PM) [snapback]1401203[/snapback]
The Whole idea of Race is not a concept of Racists, you have to aknoledge there is a difference between different Races, and of course subdivisons in different races.

For example, Whites and Blacks have different cultures and languages
Only because they have been separated, and no they don't have different languages, they are taught different languages, it isn't inbuilt.

aswell as physical charachteristics such as skull size, facial differences, body shape among other things.
Did you even read what I said in the last post, obviously not.

Also though, Whites can be split up into Alpine and Nordic subdivisons, Nordics have longer skull shapes, lighter hair and taller bodies, while Alpines have shorter more solid bodies, rounder skulls and tend to have darker hair.
Yes and these subdivisions are far more diverse from each other than black and white people.

However, these people are united (Perhaps vaguely but nevertheless united) through similar cultures, languages ect.
Says who, I look like people are german, I don't speak the same language, I don't have the same culture.

This can be observed by many words been similar through the different subdiviosions different areas(For example, use the word father, English=Father, German=Vater, Latin=Frater, Greek=Brahter, Russian=Batya.), while through different races it is completely different.
Those so called subdivisions are because it is all based off latin where father is pater, yet that proves nothing as the whole of South America speaks, Spanish and Portuguese, a lot of Africa speaks French, these aren't differences they are just taught to people, they aren't inbuilt they are just what the society made the people.

QUOTE(psychÝ @ Mar 23 2008, 06:19 PM) [snapback]1401173[/snapback]
No the difference is you

I'ze Ain't doing nothing. Society groups people, not me. Society's a biggot. Thats OK. But does nothing to refute my post and your reply was a non-sequitor... I understand that society is a biggot. Thats what my post said. Reread the post. Think about it for a few seconds, then.. if you must.. post.

The fact that your elite and choose not to use societies concepts of grouping doesn't change that white society (that is, those people who are white) expect black people to act this way, while on the hand the do not expect white people to act this way because they hold people of their own race to a higher standard...

QUOTE(Samurai_tbag @ Mar 23 2008, 09:19 PM) [snapback]1401209[/snapback]
QUOTE(BIG FUCKING SPIDER @ Mar 23 2008, 08:50 PM) [snapback]1401203[/snapback]
The Whole idea of Race is not a concept of Racists, you have to aknoledge there is a difference between different Races, and of course subdivisons in different races.

For example, Whites and Blacks have different cultures and languages, aswell as physical charachteristics such as skull size, facial differences, body shape among other things. Also though, Whites can be split up into Alpine and Nordic subdivisons, Nordics have longer skull shapes, lighter hair and taller bodies, while Alpines have shorter more solid bodies, rounder skulls and tend to have darker hair. However, these people are united (Perhaps vaguely but nevertheless united) through similar cultures, languages ect. This can be observed by many words been similar through the different subdiviosions different areas(For example, use the word father, English=Father, German=Vater, Latin=Frater, Greek=Brahter, Russian=Batya.), while through different races it is completely different.

Sorry if I explained my self a little badly.

I don't quite see what that has to do with the issue at hand.

well.. Psycho's post didn't have much to do with the issue at hand either... :-/

BIG FUCKING SPIDER is correct. Its important to acknowledge the differences in race.. lets not be so stupid and blind as to say everyone is the same.

QUOTE(psychÝ @ Mar 23 2008, 10:07 PM) [snapback]1401219[/snapback]
no they don't have different languages, they are taught different languages, it isn't inbuilt.

Well.. I guess you if you think about it that way.. no humans have any language at all... since it is all taught.. :-/. I understant the distinction your making between RACE and Ethnicity.. but i not think its a significant point to make, especially when all your arguing is the definition of the word Race....
QUOTE(Qdeathstar @ Mar 23 2008, 11:06 PM) [snapback]1401234[/snapback]
QUOTE(psychÝ @ Mar 23 2008, 06:19 PM) [snapback]1401173[/snapback]
No the difference is you

I'ze Ain't doing nothing. Society groups people, not me. Society's a biggot. Thats OK. But does nothing to refute my post and your reply was a non-sequitor... I understand that society is a biggot. Thats what my post said. Reread the post. Think about it for a few seconds, then.. if you must.. post.

The fact that your elite and choose not to use societies concepts of grouping doesn't change that white society (that is, those people who are white) expect black people to act this way, while on the hand the do not expect white people to act this way because they hold people of their own race to a higher standard...
You are presuming that society has these assumptions, whereas maybe they don't and you are just assuming they do as to convince yourself you are not being racist, where as I agree to an extent to your point, I would say it is more the clothes someone is wearing than the colour of there skin that creates my opinion of someone.

You seem to be excusing your actions because everyone else is doing it, just cause everyone else is doing it doesn't mean it is right.


BIG FUCKING SPIDER is correct. Its important to acknowledge the differences in race.. lets not be so stupid and blind as to say everyone is the same.
What so you can discriminate (in a positive or negative way) against them or other groups of society, why is it stupid to treat everyone as the same, what is really different between a black kid and white kid. Yes, if the black kid lives in a ghetto and the white kid lives in Beverly hills there is a difference (however in the case of this argument it is beside the point) but when taking two kids from the same neighbourhood there really isn't much parting them apart from societies stereotypes.

QUOTE(psychÝ @ Mar 23 2008, 10:07 PM) [snapback]1401219[/snapback]
no they don't have different languages, they are taught different languages, it isn't inbuilt.

Well.. I guess you if you think about it that way.. no humans have any language at all... since it is all taught.. :-/.
Finally you are starting to get the point, all the concepts are taught, yes a white kid might be better than a black kid at maths but then another black kid sitting the other side of the table maybe better than the white kid, the fact they are white or black is irrelevant, they are just 3 kids at a table doing maths.

especially when all your arguing is the definition of the word Race....

No it isn't my argument is race is something made up by society that is used to pointlessly group people into irrelevant groups with no actual meaning.

To bring it back to the point of this topic, would anyone care if a group of white kids had beaten up a white kid, or is it societies fault that black on white or white on black crimes are classed as so much more important.
Mister Triangle
QUOTE(psychÝ @ Mar 23 2008, 01:19 PM) [snapback]1401173[/snapback]
All humans are very similar genetically. There are more differences within a ďraceĒ than between ďracesĒ.

8/10th diversity = differences between people
of the same country.
1/10th diversity = differences between nations.
1/10th diversity = differences between ďracesĒ.

So all you ignorant bigots can really just go fuck yourself unless of course you have some better data. (going to love to see this)

If you want the best data available then go read Rathus' Psychology book: Concepts & Connections Ninth & Tenth editions. They're standard books in college and delve quite deeply into the differences between races and unfortunately for negros, it doesn't look too good for them but it's not racist it's just the truth of what is. It's evident that negros will never be able to fit into America and anyone that says otherwise is a delusional liberal.
QUOTE(Mister Triangle @ Mar 24 2008, 02:52 AM) [snapback]1401297[/snapback]
QUOTE(psychÝ @ Mar 23 2008, 01:19 PM) [snapback]1401173[/snapback]
All humans are very similar genetically. There are more differences within a “race” than between “races”.

8/10th diversity = differences between people
of the same country.
1/10th diversity = differences between nations.
1/10th diversity = differences between “races”.

So all you ignorant bigots can really just go fuck yourself unless of course you have some better data. (going to love to see this)

If you want the best data available then go read Rathus' Psychology book: Concepts & Connections Ninth & Tenth editions. They're standard books in college and delve quite deeply into the differences between races and unfortunately for negros, it doesn't look too good for them but it's not racist it's just the truth of what is. It's evident that negros will never be able to fit into America and anyone that says otherwise is a delusional liberal.

Yeah, i'm doing a degree in genetics so I know you are talking BS because those are the facts.

What a bigot.

Even more entertaining why would they be using a psychology book on a genetics course, I mean damn moron, there are specialist books for genetics and population genetics, why would we read a psychology book, let alone 2 which will be very much the same apart from the 9th edition being less up to date.

Edit: Anyway just for kicks to see the hilarity of your data, give me a reference including page number and subtitle just so I can laugh at your statement, considering I now have a copy of the book in front of me.
QUOTE(psychÝ @ Mar 24 2008, 03:28 AM) [snapback]1401307[/snapback]
Edit: Anyway just for kicks to see the hilarity of your data, give me a reference including page number and subtitle just so I can laugh at your statement, considering I now have a copy of the book in front of me.

Looks like he got done, haha.
Mister Triangle
QUOTE(psychÝ @ Mar 23 2008, 11:28 PM) [snapback]1401307[/snapback]
All humans are very similar genetically. There are more differences within a ďraceĒ than between ďracesĒ.

8/10th diversity = differences between people
of the same country.
1/10th diversity = differences between nations.
1/10th diversity = differences between ďracesĒ.

So all you ignorant bigots can really just go fuck yourself unless of course you have some better data. (going to love to see this)

Yeah, i'm doing a degree in genetics so I know you are talking BS because those are the facts.

What a bigot.

Even more entertaining why would they be using a psychology book on a genetics course, I mean damn moron, there are specialist books for genetics and population genetics, why would we read a psychology book, let alone 2 which will be very much the same apart from the 9th edition being less up to date.

Edit: Anyway just for kicks to see the hilarity of your data, give me a reference including page number and subtitle just so I can laugh at your statement, considering I now have a copy of the book in front of me.

ACTUALLY, The genetic differences between whites & blacks are
Here. Laugh at this lil' puddin'.
HEREDITY: The transmission of traits from parent to offspring by means of genes
GENETICS: The area of biology that focuses on biology.
BEHAVIORAL GENETICS: The area of biology & psychology that focuses on the transmission of traits that give rise to behavior. Behavioral genetics also addresses individial differences in behavior.

IF you were studying genetics then you would know that there are differences between races. AWw! I bet you use the UK liberal fantasy nimrod version 3.1-4! If you have the book: Psychology: Concepts & Connections Ninth Edition there genius then I SUGGEST THAT YOU READ ALL OF CHAPTER 9: Start with chapter 2: Biology & Psychology page 47: Genetics & Behavioral Genetics-- & get ready to get your ass schooled, son.

Here's an excerpt from Genetic Influences On Intelligence:
"In other words, variations(the technical term is variance) in IQ scores CAN BE ACCOUNTED FOR BY HEREDITY. It means, rather, that about half of the difference between your IQ score and the IQ scores of other races CAN BE EXPLAINED IN TERMS OF GENETIC FACTORS".

"Psychologist can point with pride to a rich mine of contemporary research on the roles of nature(GENETIC INFLUENCES) --in the developement of intelligence". "It is also true that african-Americans IQ scores are considerably lower than whites according to The BELL CURVE STUDY". Intelligence IS contributed to genetics. Read THE BELL CURVE STUDY.
Thrilla in Manila
only way to get media coverage is if they didn't get punished for it, if they got over-sentenced the whole country would be on their side

when shit like this happens there is no way white people can win... I'm not white either I'm just saying alot of white people are scary asses that don't speak up when they need to

also, fuck up triangle

obama isn't even black you dumbass
Mister Triangle
He's half, dumbboy and he's a covert mo-slum at that. And no whites from the country are scared of any minority, it's the other way around. Remember what happened the last time that the black panthers tried to march through texas last year? They left in a big hurry! Running like little sissies. You can watch it on youtube. They know better.

In Abraham Lincoln's Emancipation Proclamation of Sept. 1862 he said:

"I have urged the colonization of the Negroes, (back to Africa), and I shall continue. My Emancipation Proclamation was linked with this plan (of colonization).

There is no room for two distinct races of White men in America, much less for two distinct races of Whites and Blacks.

. . . I can think of no greater calamity than the assimilation of the negro into our social and political life as our equal . . .

Within twenty years we can peacefully colonize the Negro . . . under conditions in which he can rise to the full measure of manhood. This he can never do here. We can never attain the ideal union our fathers dreamed, with millions of an alien, inferior race among us, whose assimilation is neither possible nor desirable."

Lincoln actually proposed an amendment to the constitution that would've authorized congress to recolonize all freed Blacks back to Africa. On Aug. 15, l962, Congress did appropriate over half a million dollars for that purpose. Thousands of Negroes had been shipped back when Lincoln was shot.
QUOTE(Mister Triangle @ Mar 25 2008, 10:15 PM) [snapback]1401425[/snapback]
There is no room for two distinct races of White men in America, much less for two distinct races of Whites and Blacks.

Here's where your 'facts' are wrong.

Hispanics: 12.5%

Blacks: 12.4%

The two biggest groups are White and Hispanic.


ACTUALLY, The genetic differences between whites & blacks are
Here. Laugh at this lil' puddin'.
HEREDITY: The transmission of traits from parent to offspring by means of genes
GENETICS: The area of biology that focuses on biology.
BEHAVIORAL GENETICS: The area of biology & psychology that focuses on the transmission of traits that give rise to behavior. Behavioral genetics also addresses individial differences in behavior.

The area of biology that focuses on biology...............................that is what you said, seriously where do I start? Do I start? Can I really be bothered to start?

Let sum it up with just really simple points, cause it is quite clear you didn't copy and paste that from anywhere and actually think you know something about the subject, oh dear.

1) Heredity is genetics, it is the whole point in studying genetics, do you really think anyone cares that gene on the P arm of the Y chromosome the allele coding for an androgen receptors polynucleotide sequence is ATGCAGCTATCGGCCTATAG, no, no one really gives a fuck they care what that code does and why it does it.

2) Your definition of genetics is just a joke, it is the study of DNA and the genome, the affects this has on the phenotype of an organism and how this is information is passed to the next generation and the mechanism of doing this.

3) Psychology is not genetics in anyway, Psychology would be defined as a phenotypic characteristic in genetics.


IF you were studying genetics then you would know that there are differences between races.
I never said there weren't, I purely said it is a completely irrelevant difference unless we are talking about your chances of getting skin cancer or needing vitamin D supplements.

SUGGEST THAT YOU READ ALL OF CHAPTER 9: Start with chapter 2: Biology & Psychology page 47: Genetics & Behavioral Genetics-- & get ready to get your ass schooled, son.
And what is that supposed to prove exactly?


Here's an excerpt from Genetic Influences On Intelligence:
"In other words, variations(the technical term is variance) in IQ scores CAN BE ACCOUNTED FOR BY HEREDITY. It means, rather, that about half of the difference between your IQ score and the IQ scores of other races CAN BE EXPLAINED IN TERMS OF GENETIC FACTORS".
Apart from the fact that IQ is a very poor way to judge intelligence mainly based on these reasons:
    - Standardisation of the test towards white middle class America (A very prominent point)
    - Discrimination
    - Socio-economic status
    - Language
    - Motivation
What you are proposing is that a group of kids from a poorly funded school, with parents on minimum wage meaning they may not have enough food and nourishment or school books, who have to walk rather than get the bus, in an underfunded school, which has worse equipment, doing a test where the question might not make sense to them, (anyone done one of those shitty IQ test that asks you how many nickels and dimes you need to make $5, how the fuck am I supposed to know how much a nickel or dime is worth use really numbers for coins you morons) should on average do as well as a group of middle class American white kids who got drove to school in there Range Rover Sport, after there daddy brought them a new computer to use the CD the school provided for them so they can interactive homework lesson.

Yeah good one.


"Psychologist can point with pride to a rich mine of contemporary research on the roles of nature(GENETIC INFLUENCES)
Oh dear, I mean really clearly you are just an idiot trying to pretend to be clever, the role of nature doesn't mean genetic, it has many connotation.
"It is also true that african-Americans IQ scores are considerably lower than whites according to The BELL CURVE STUDY".

Oh god don't get be started on that book, lets take a group of african immigrants and then compare there data to a group of middle class Americans which the test was standardised for them to understand. The black kids actually did surprising well in that study considering there social background.

Intelligence IS contributed to genetics.
Cool so if I get more intelligent my DNA base pairing changes, remember that kids. Moron.

Yeah, I already know about it, it's a bunch of BS science with incorrect assumptions based on purposely bad data, Garbage in = Garbage out

He's half, dumbboy and he's a covert mo-slum at that. And no whites from the country are scared of any minority, it's the other way around. Remember what happened the last time that the black panthers tried to march through texas last year? They left in a big hurry! Running like little sissies. You can watch it on youtube. They know better.
In Abraham Lincoln's Emancipation Proclamation of Sept. 1862 he said:
"I have urged the colonization of the Negroes, (back to Africa), and I shall continue. My Emancipation Proclamation was linked with this plan (of colonization).
There is no room for two distinct races of White men in America, much less for two distinct races of Whites and Blacks.
. . . I can think of no greater calamity than the assimilation of the negro into our social and political life as our equal . . .
Within twenty years we can peacefully colonize the Negro . . . under conditions in which he can rise to the full measure of manhood. This he can never do here. We can never attain the ideal union our fathers dreamed, with millions of an alien, inferior race among us, whose assimilation is neither possible nor desirable."
Lincoln actually proposed an amendment to the constitution that would've authorized congress to recolonize all freed Blacks back to Africa. On Aug. 15, l962, Congress did appropriate over half a million dollars for that purpose. Thousands of Negroes had been shipped back when Lincoln was shot.

BLAH BLAH BLAH, do I look like I give a shit about some bigot from history, nay.

Now with your vast exorbitant knowledge in genetic and momentous research papers and sources go find me one gene inexplicably linked to intelligence that will decrease it or increase it in the general population oh and then don't forget to link it to race, so you better make that a intelligence and skin colour gene.

Oh and don't post in this topic again if you can't.
Mister Triangle
All that shit that your mommy just typed; BULLSHIT! Inacurate. Biased as hell. Absolute & complete utter NONSENSE!

Yeah. All the data about the intelligence of the african-American is racist & wrong. Yeah. Sounds just like a buncha liberal shit to me. "If you can't agree with me then don't post again" or "white middle-class america is responsible for how dumb blacks are"...No, liberal. You are wrong and you'll never shut me up and you're in my thread nancy so get the fuck out nigger lover unless you have data from credible UNBIASED sources like I do like THE BELL CURVE STUDY OR THE U.S. DEPT. OF JUSTICE CRIME STATISTICS OR THE FBI CRIME REPORTS! Aww. They're all wrong too. I forgot.

"Apart from the fact that IQ is a very poor way to judge intelligence mainly based on these reasons:
- Standardisation of the test towards white middle class America (A very prominent point)
- Discrimination
- Socio-economic status
- Language
- Motivation"

Yeah. MmmHmmm. rolleyes.gif That and the fact that you can't fix stupid nor change genetics or can you try some liberal tactic of blaming it on some bogus factor. Stupid IS stupid does. Didn't you watch Forest Gump? Damn! Bubba was so damn stupid that he thought chicken was shrimp.

Quit having your mommy come down in the basement and type shit for ya. She don't know what the hell she's talkin' 'bout. You sir, are a fool. And tell uncle tyrone to quit eatin' all the chicken.
Well that is pretty much owned.

I am done here. smile.gif
I swear to some fucking asshole of a god, if your facts are only from three sources your conclusions are not even expansive enough to be unbiased themselves being based on so few let alone that you passionately believe there is such thing as an unbiased source...
I have to agree with psycho, race makes little diffrence. I have at least one friend from every ethnic background I can think off and the last thing I rate them by his their race.

I only have one friend from an african background but I still don't see the difrence between him and a white man. He has terrible english, but so could a white man from his part of Africa.
Just want to put my two pence (cents) in...

Mister Triangle strikes me to be (like most racists) to be obsessed with losing their "white women" to the Black man, I mean how many times can you mention the word surprise sex! 34,000 accounts of surprise sex? Sounds pretty high to me, but then it might be interested to hear the statistics on black women being raped in the South. But then itís probably pretty low right? Well who is going to call the cops when it was probably one of them raping them last night?

One white kid gets punched and itís not on the news and you think there is a media conspiracy? Right well tell you what, what is worse than surprise sex & murder? Paedophilia. Who are the majority of paedophiles? White males, and yet the black man is supposed to be dangerous? Iím not saying they donít do it but lets face it men in general are pretty fucked up. Raping a three month old baby seems just a little worse to me than punching a man in the face and Iím quite glad that what with wars, famine, natural disasters the media decided to ignore something (although still shocking) quite trivial.

Also Aids in Africa? Surprisingly is a recent thing, remember America in the 80ís Ė actually donít because youíll just start bad mouthing ďthe gaysĒ.

In regards to other peopleís comments I think that Culture and upbringing play a bigger part in our behaviour than our genetics. Iím mixed race, my mother is White/Welsh and my father Black/South American. He was raised in South America which is the only English speaking country in South America and was once a British Colony and from the stereotypes this forum has been spitting out he couldnít be more different. And yet to look at him, he is big, black (yes thick lips and all) but to speak to him you can only hear the British language, just because he is black doesnít mean he speaks differently, it was how he was raised (being made to write out and remember the whole dictionary probably helped).

I am not defined by the colour of my skin but by the integrity of my actions and the respect I give and expect from others.
Severus Snape
Just want to put my two pence (cents) in...

Mister Triangle strikes me to be (like most racists) to be obsessed with losing their "white women" to the Black man, I mean how many times can you mention the word surprise sex! 34,000 accounts of surprise sex? Sounds pretty high to me, but then it might be interested to hear the statistics on black women being raped in the South. But then itís probably pretty low right? Well who is going to call the cops when it was probably one of them raping them last night?
Why all the hate towards Mr. Triangle? He isn't racist - he just calls them like he sees them.


One white kid gets punched and itís not on the news and you think there is a media conspiracy?

Ah, but if it was a black kid getting punched by a white kid, it'd be national news. A hate crime. Get Jesse Jackson involved so we can all have some equality!


Right well tell you what, what is worse than surprise sex & murder? Paedophilia. Who are the majority of paedophiles? White males,
wtf? how is this relevant to the topic at hand?


and yet the black man is supposed to be dangerous? Iím not saying they donít do it but lets face it men in general are pretty fucked up.

I disagree. I think all PEOPLE are generally messed up, not just the men.


Raping a three month old baby seems just a little worse to me than punching a man in the face and Iím quite glad that what with wars, famine, natural disasters the media decided to ignore something (although still shocking) quite trivial.
Again - wtf? how is this relevant.
And again - if it was a black kid getting punched by a white kid, we'd have a national fucking crisis on our hands due to the severity of this "hate crime".


Also Aids in Africa? Surprisingly is a recent thing, remember America in the 80ís Ė actually donít because youíll just start bad mouthing ďthe gaysĒ.

I agree with you on this point. Many people still to this day think that homosexuals are the reason and cause for AIDS.


In regards to other peopleís comments I think that Culture and upbringing play a bigger part in our behaviour than our genetics.
Not sure I agree with this statement. I think both culture AND genetics play an equal part. This is a debate that won't ever have a definitive answer (not in my lifetime anyhow). There are studies that prove this both ways, and neither side is budging or backing down.


Iím mixed race, my mother is White/Welsh and my father Black/South American. He was raised in South America which is the only English speaking country in South America

So, he was raised in South America? Which part was that again? Your idiocy is on full display here...

and was once a British Colony and from the stereotypes this forum has been spitting out he couldnít be more different.
Stereotypes don't define a person, they define a group of people. And with all rules there are exceptions.


And yet to look at him, he is big, black (yes thick lips and all) but to speak to him you can only hear the British language, just because he is black doesnít mean he speaks differently, it was how he was raised (being made to write out and remember the whole dictionary probably helped).

which language is that, exactly? Didn't realize that British was a language. Again, your idiocy is on full display. Your father may be intelligent, but obviously none of those GENES passed on to you. Which kind of proves that culture plays a bigger part in all of this than I originally thought....

I am not defined by the colour of my skin but by the integrity of my actions and the respect I give and expect from others.

The most intelligent thing I have read on this forum yet. Let our actions speak for our character, and not the color of our skin.
Thanks for the analysis.
QUOTE(Arch Angel @ Mar 27 2008, 12:02 PM) [snapback]1401790[/snapback]
Iím mixed race, my mother is White/Welsh and my father Black/South American. He was raised in South America which is the only English speaking country in South America

So, he was raised in South America? Which part was that again? Your idiocy is on full display here...

The only thing I'd like to come back on is this one (as we are all entitled to our opinions). Sorry I meant Guyana in South America - see official language

...Oh and sorry I meant English Language and that not all Black people speak patois or say innit after every word etc.
QUOTE(Flism @ Mar 27 2008, 09:43 PM) [snapback]1401774[/snapback]
One white kid gets punched and itís not on the news and you think there is a media conspiracy?

Well, being picky about what they put on the news can hardly qualify as a crime like conspiracy, but we do think it's stupid.

Right well tell you what, what is worse than surprise sex & murder? Paedophilia. Who are the majority of paedophiles? White males, and yet the black man is supposed to be dangerous?


The majority of people in America Australia, the UK and most europian countries are white so clearly there are more white Paedophiles, just like there would be more white anything.
Screw Loose
Wait now... whats wrong with liberals? I know communists are wrong, but whats wrong with liberals? They seem to be the only group right now that doesn't have its head stuck in its ass

Enough with the GTA: San Andreas insults.

BTW: I've seen my friends (whom are white) knock the shit out of a few blacks (Not 1-on-1 either, he started losing and then all the whites jumped in), and that shit isn't on the news either. That pretty much kills this argument.
QUOTE(Skinny. @ Mar 28 2008, 06:52 AM) [snapback]1402244[/snapback]
Right well tell you what, what is worse than surprise sex & murder? Paedophilia. Who are the majority of paedophiles? White males, and yet the black man is supposed to be dangerous?


The majority of people in America Australia, the UK and most europian countries are white so clearly there are more white Paedophiles, just like there would be more white anything.

They must have some kind of percentage, or crimes per head as otherwise as you say it is just complete BS and useless data.
This is a "lo-fi" version of our main content. To view the full version with more information, formatting and images, please click here.
Invision Power Board © 2001-2015 Invision Power Services, Inc.