IPB

Welcome Guest ( Log In | Register )

3 Pages V  < 1 2 3 >  
Reply to this topicStart new topic
> A Pack of Blacks Beat Lone White Kid, Where's the media? Where's the outrage??
new major on the...
post Mar 23 2008, 01:49 AM
Post #21


Pickpocket
*

Group: Members
Posts: 106
Joined: 22-December 06
From: Houston "the bayou city aka space city",Tx
Member No.: 34,134
PSN Name: ARCHmajor



QUOTE(LattO @ Mar 21 2008, 08:23 PM) [snapback]1400822[/snapback]
Mister triangle, you just made yourself look like a complete idiot.

The best fighters in the world are Black, and i could bet alot of money that they've taken on many Whites, Asians, and Hispanics one on one, and probably won.


I'm sorry but I'll take a well trained asian in martial arts over any black, white or hispanic any day.
Achievements
Go to the top of the page
 
+Quote Post
Mister Triangle
post Mar 23 2008, 03:22 AM
Post #22


Upstanding Citizen


Group: Members
Posts: 0
Joined: 29-December 07
From: West Virginia
Member No.: 38,169



QUOTE(LattO @ Mar 22 2008, 05:59 PM) [snapback]1401025[/snapback]
QUOTE(Mister Triangle @ Mar 22 2008, 11:36 AM) [snapback]1400973[/snapback]
Jibberish


You honestly rambled on about nothing important.

If you want to bring back stats and i'm not going to waste my time looking up bullshit, but not too long ago whites were raping and slaughtering every black on site.

Stats don't mean shit.

What do inventions have to do with this whole argument?
What does whites being first in africa have to do with this argument?

You're rambling on to make the "white" race sound superior to all.

And point blank, you're making yourself seem more and more of a dumbass.


Liberals don't like to hear stats. Especially ones with direct links to gov. websites. Whites NEVER raped or murdered in the numbers that negros are now. Negros have murdered more people than all the people killed in all wars combined. Don't you get it!? Or are you just a dumbboy? It's funny how when someone points out the black problem, they automatically become a "dumbass' or 'inbred rednecks'.

Samurai Tbag, Your so-called free healthcare is a flawed joke at best. Crimes ARE race related. Did you check the link that I provided to The U.S. Dept. Of Justice????? Jesus H. Christ! It's not gangs, it's negros! You should educate yourself a little more. I'm not trying to start a race war. That will happen the next time blacks riot. We will see a race war in our lifetime and it won't be pretty. War never is.

Did you know that when the blacks savagely gang beat the innocent whites in Jena and the busloads of blacks were pouring in so they could start looting, raping, and murdering that whites from all over the U.S. was surrounding Jena. The hotels were packed. Me & 12 others from where I live took our vacations & drove out & stayed a week waiting. That's the only reason that I know. The media never said shit about it because they knew that it was a hair trigger and word got back to Al Sharpton & Jesse Jackson and they went around in a hush tone telling the masses to not even think about it. The black panthers sent out scouts that were being watched every inch that they covered and they knew it! They came right by our hotel and looked quite nervous when they seen the parking lot was more than full with mad white mf'ers. Shit was about to get deep and not too many even know how close it came. I think thats amazing that it has been kept on the down low but the media can do that.

The hotel that I was in didn't have a room left. People were in the parking lots and I couldn't figure out why until I went around & started talking and I was greatful that there were so many that thinks enough of the white race to show up and lend support. It was a scary moment and you'll hardly ever hear me say that. As far as America heading for recession, you're correct. There's no denying that. You know why? Because of filthy, greedy jews in New York.

They're in a greed feeding frenzy and it will cause a depression and then shits gonna get ugly. The trash will be taken out in America and we will have to start anew. Times are gonna get tough. Hell, they already are. Gas right now is $3.49 a gallon where I live and gauranteed to hit $4.00 by the end of spring and groceries are unbelievable too. Diesel is $4.09 so truckers will be striking soon and the country will stop. We'll have to go back to the old way of living by hunting and living off the land. People in the cities will starve to death & die because they have no common sense or idea how to survive. I'm glad I hunt & fish and can everything. I have enough for atleast 2 years in my cellar.
Achievements
Go to the top of the page
 
+Quote Post
Hardcore Ottoman
post Mar 23 2008, 03:40 AM
Post #23


Goon
Group Icon

Group: Gold Member
Posts: 469
Joined: 2-August 04
Member No.: 41
PSN Name: punxtr



Your slippery slope is hilarious... we won't be going back to nomadic lifestyles--we'll simply see lots of bad stories containing peoples that simple could not afford to commute to work to live and support their family. That is, if it ever becomes that bad, which I hope it won't.


--------------------
"BAKING A LASAGNA IN YOUR PUNANI MIKE PARADINAS IN YOUR PUNANI INTELLVISION BASKETBALL IN YOUR PUNANI HE-MAN AND SKELETOR IN YOUR PUNANI UNDERGOING PLASTIC SURGERY IN YOUR PUNANI WEARING LEATHER JACKETS IN YOUR PUNANI DRIVING MY CAR IN YOUR PUNANI WELFARE WEDNESDAY IN YOUR PUNANI I WANT TO PUT ORANGE JUICE IN YOUR PUNANI EGG SALAD SANDWICHES IN YOUR PUNANI HOT-DOGS AND FRENCH FRIES IN YOUR PUNANI CHEF BOYARDEE IN YOUR PUNANI"
Achievements
Go to the top of the page
 
+Quote Post
Samurai_tbag
post Mar 23 2008, 12:48 PM
Post #24


Upstanding Citizen


Group: Members
Posts: 0
Joined: 12-November 04
From: Brighton, UK
Member No.: 5,211



QUOTE(Mister Triangle @ Mar 23 2008, 03:22 AM) [snapback]1401079[/snapback]
Samurai Tbag, Your so-called free healthcare is a flawed joke at best. Crimes ARE race related.

Er, how do you explain accidents? Or, you think the guy dying of cancer has been attacked? Lol. Oh dear, someone help this guy.

QUOTE(Mister Triangle @ Mar 23 2008, 03:22 AM) [snapback]1401079[/snapback]
As far as America heading for recession, you're correct. There's no denying that. You know why? Because of filthy, greedy jews in New York.

The jews in New York are nothing to do with it. It's to do with poor management from Cheney's White House. If anything, rich 'jews' are keeping whats left of the economy running.


--------------------
Achievements
Go to the top of the page
 
+Quote Post
Qdeathstar
post Mar 23 2008, 02:52 PM
Post #25


My Penis, Your ass. Lets go.
Group Icon

Group: Gold Member
Posts: 420
Joined: 2-August 04
From: Virginia Beach
Member No.: 14



The difference is, that white people expect this sort of mindless violence from black people, and on the other hand white people don't expect this sort of mindless violence from white people.


--------------------

Seether - Country Song
Download Now

QUOTE (Massacre @ Aug 26 2010, 04:28 PM) *
I've found it's impossible to be more human than human. Inhuman, however, is easy.



Achievements
Go to the top of the page
 
+Quote Post
psychÝ
post Mar 23 2008, 06:19 PM
Post #26


Upstanding Citizen


Group: Members
Posts: 0
Joined: 26-August 04
From: The Steel City, England
Member No.: 1,279



QUOTE(Qdeathstar @ Mar 23 2008, 02:52 PM) [snapback]1401155[/snapback]
The difference is, that white people expect this sort of mindless violence from black people, and on the other hand white people don't expect this sort of mindless violence from white people.

No the difference is you are all racist for putting them into groups, the whole idea of race was made by racists, I know none of you have a clue how different blacks and whites actually are so lets some it up with some real data.

All humans are very similar genetically. There are more differences within a ďraceĒ than between ďracesĒ.

8/10th diversity = differences between people
of the same country.
1/10th diversity = differences between nations.
1/10th diversity = differences between ďracesĒ.

So all you ignorant bigots can really just go fuck yourself unless of course you have some better data. (going to love to see this)


--------------------

Dragonfly
Achievements
Go to the top of the page
 
+Quote Post
BIG FUCKING SPID...
post Mar 23 2008, 08:50 PM
Post #27


Upstanding Citizen


Group: Members
Posts: 0
Joined: 25-March 05
From: Leeds
Member No.: 10,974



The Whole idea of Race is not a concept of Racists, you have to aknoledge there is a difference between different Races, and of course subdivisons in different races.

For example, Whites and Blacks have different cultures and languages, aswell as physical charachteristics such as skull size, facial differences, body shape among other things. Also though, Whites can be split up into Alpine and Nordic subdivisons, Nordics have longer skull shapes, lighter hair and taller bodies, while Alpines have shorter more solid bodies, rounder skulls and tend to have darker hair. However, these people are united (Perhaps vaguely but nevertheless united) through similar cultures, languages ect. This can be observed by many words been similar through the different subdiviosions different areas(For example, use the word father, English=Father, German=Vater, Latin=Frater, Greek=Brahter, Russian=Batya.), while through different races it is completely different.

Sorry if I explained my self a little badly.

This post has been edited by BIG FUCKING SPIDER: Mar 23 2008, 08:51 PM
Achievements
Go to the top of the page
 
+Quote Post
Samurai_tbag
post Mar 23 2008, 09:19 PM
Post #28


Upstanding Citizen


Group: Members
Posts: 0
Joined: 12-November 04
From: Brighton, UK
Member No.: 5,211



QUOTE(BIG FUCKING SPIDER @ Mar 23 2008, 08:50 PM) [snapback]1401203[/snapback]
The Whole idea of Race is not a concept of Racists, you have to aknoledge there is a difference between different Races, and of course subdivisons in different races.

For example, Whites and Blacks have different cultures and languages, aswell as physical charachteristics such as skull size, facial differences, body shape among other things. Also though, Whites can be split up into Alpine and Nordic subdivisons, Nordics have longer skull shapes, lighter hair and taller bodies, while Alpines have shorter more solid bodies, rounder skulls and tend to have darker hair. However, these people are united (Perhaps vaguely but nevertheless united) through similar cultures, languages ect. This can be observed by many words been similar through the different subdiviosions different areas(For example, use the word father, English=Father, German=Vater, Latin=Frater, Greek=Brahter, Russian=Batya.), while through different races it is completely different.

Sorry if I explained my self a little badly.

I don't quite see what that has to do with the issue at hand.



--------------------
Achievements
Go to the top of the page
 
+Quote Post
psychÝ
post Mar 23 2008, 10:07 PM
Post #29


Upstanding Citizen


Group: Members
Posts: 0
Joined: 26-August 04
From: The Steel City, England
Member No.: 1,279



QUOTE(BIG FUCKING SPIDER @ Mar 23 2008, 08:50 PM) [snapback]1401203[/snapback]
The Whole idea of Race is not a concept of Racists, you have to aknoledge there is a difference between different Races, and of course subdivisons in different races.

For example, Whites and Blacks have different cultures and languages
Only because they have been separated, and no they don't have different languages, they are taught different languages, it isn't inbuilt.

QUOTE
aswell as physical charachteristics such as skull size, facial differences, body shape among other things.
Did you even read what I said in the last post, obviously not.

QUOTE
Also though, Whites can be split up into Alpine and Nordic subdivisons, Nordics have longer skull shapes, lighter hair and taller bodies, while Alpines have shorter more solid bodies, rounder skulls and tend to have darker hair.
Yes and these subdivisions are far more diverse from each other than black and white people.

QUOTE
However, these people are united (Perhaps vaguely but nevertheless united) through similar cultures, languages ect.
Says who, I look like people are german, I don't speak the same language, I don't have the same culture.

QUOTE
This can be observed by many words been similar through the different subdiviosions different areas(For example, use the word father, English=Father, German=Vater, Latin=Frater, Greek=Brahter, Russian=Batya.), while through different races it is completely different.
Those so called subdivisions are because it is all based off latin where father is pater, yet that proves nothing as the whole of South America speaks, Spanish and Portuguese, a lot of Africa speaks French, these aren't differences they are just taught to people, they aren't inbuilt they are just what the society made the people.



--------------------

Dragonfly
Achievements
Go to the top of the page
 
+Quote Post
Qdeathstar
post Mar 23 2008, 11:06 PM
Post #30


My Penis, Your ass. Lets go.
Group Icon

Group: Gold Member
Posts: 420
Joined: 2-August 04
From: Virginia Beach
Member No.: 14



QUOTE(psychÝ @ Mar 23 2008, 06:19 PM) [snapback]1401173[/snapback]
No the difference is you


I'ze Ain't doing nothing. Society groups people, not me. Society's a biggot. Thats OK. But does nothing to refute my post and your reply was a non-sequitor... I understand that society is a biggot. Thats what my post said. Reread the post. Think about it for a few seconds, then.. if you must.. post.


The fact that your elite and choose not to use societies concepts of grouping doesn't change that white society (that is, those people who are white) expect black people to act this way, while on the hand the do not expect white people to act this way because they hold people of their own race to a higher standard...




QUOTE(Samurai_tbag @ Mar 23 2008, 09:19 PM) [snapback]1401209[/snapback]
QUOTE(BIG FUCKING SPIDER @ Mar 23 2008, 08:50 PM) [snapback]1401203[/snapback]
The Whole idea of Race is not a concept of Racists, you have to aknoledge there is a difference between different Races, and of course subdivisons in different races.

For example, Whites and Blacks have different cultures and languages, aswell as physical charachteristics such as skull size, facial differences, body shape among other things. Also though, Whites can be split up into Alpine and Nordic subdivisons, Nordics have longer skull shapes, lighter hair and taller bodies, while Alpines have shorter more solid bodies, rounder skulls and tend to have darker hair. However, these people are united (Perhaps vaguely but nevertheless united) through similar cultures, languages ect. This can be observed by many words been similar through the different subdiviosions different areas(For example, use the word father, English=Father, German=Vater, Latin=Frater, Greek=Brahter, Russian=Batya.), while through different races it is completely different.

Sorry if I explained my self a little badly.

I don't quite see what that has to do with the issue at hand.


well.. Psycho's post didn't have much to do with the issue at hand either... :-/

BIG FUCKING SPIDER is correct. Its important to acknowledge the differences in race.. lets not be so stupid and blind as to say everyone is the same.

QUOTE(psychÝ @ Mar 23 2008, 10:07 PM) [snapback]1401219[/snapback]
no they don't have different languages, they are taught different languages, it isn't inbuilt.


Well.. I guess you if you think about it that way.. no humans have any language at all... since it is all taught.. :-/. I understant the distinction your making between RACE and Ethnicity.. but i not think its a significant point to make, especially when all your arguing is the definition of the word Race....


--------------------

Seether - Country Song
Download Now

QUOTE (Massacre @ Aug 26 2010, 04:28 PM) *
I've found it's impossible to be more human than human. Inhuman, however, is easy.



Achievements
Go to the top of the page
 
+Quote Post
psychÝ
post Mar 23 2008, 11:36 PM
Post #31


Upstanding Citizen


Group: Members
Posts: 0
Joined: 26-August 04
From: The Steel City, England
Member No.: 1,279



QUOTE(Qdeathstar @ Mar 23 2008, 11:06 PM) [snapback]1401234[/snapback]
QUOTE(psychÝ @ Mar 23 2008, 06:19 PM) [snapback]1401173[/snapback]
No the difference is you


I'ze Ain't doing nothing. Society groups people, not me. Society's a biggot. Thats OK. But does nothing to refute my post and your reply was a non-sequitor... I understand that society is a biggot. Thats what my post said. Reread the post. Think about it for a few seconds, then.. if you must.. post.


The fact that your elite and choose not to use societies concepts of grouping doesn't change that white society (that is, those people who are white) expect black people to act this way, while on the hand the do not expect white people to act this way because they hold people of their own race to a higher standard...
You are presuming that society has these assumptions, whereas maybe they don't and you are just assuming they do as to convince yourself you are not being racist, where as I agree to an extent to your point, I would say it is more the clothes someone is wearing than the colour of there skin that creates my opinion of someone.

You seem to be excusing your actions because everyone else is doing it, just cause everyone else is doing it doesn't mean it is right.


QUOTE

BIG FUCKING SPIDER is correct. Its important to acknowledge the differences in race.. lets not be so stupid and blind as to say everyone is the same.
What so you can discriminate (in a positive or negative way) against them or other groups of society, why is it stupid to treat everyone as the same, what is really different between a black kid and white kid. Yes, if the black kid lives in a ghetto and the white kid lives in Beverly hills there is a difference (however in the case of this argument it is beside the point) but when taking two kids from the same neighbourhood there really isn't much parting them apart from societies stereotypes.

QUOTE
QUOTE(psychÝ @ Mar 23 2008, 10:07 PM) [snapback]1401219[/snapback]
no they don't have different languages, they are taught different languages, it isn't inbuilt.

Well.. I guess you if you think about it that way.. no humans have any language at all... since it is all taught.. :-/.
Finally you are starting to get the point, all the concepts are taught, yes a white kid might be better than a black kid at maths but then another black kid sitting the other side of the table maybe better than the white kid, the fact they are white or black is irrelevant, they are just 3 kids at a table doing maths.

QUOTE
especially when all your arguing is the definition of the word Race....

No it isn't my argument is race is something made up by society that is used to pointlessly group people into irrelevant groups with no actual meaning.

To bring it back to the point of this topic, would anyone care if a group of white kids had beaten up a white kid, or is it societies fault that black on white or white on black crimes are classed as so much more important.

This post has been edited by psychÝ: Mar 24 2008, 01:48 AM


--------------------

Dragonfly
Achievements
Go to the top of the page
 
+Quote Post
Mister Triangle
post Mar 24 2008, 02:52 AM
Post #32


Upstanding Citizen


Group: Members
Posts: 0
Joined: 29-December 07
From: West Virginia
Member No.: 38,169



QUOTE(psychÝ @ Mar 23 2008, 01:19 PM) [snapback]1401173[/snapback]
All humans are very similar genetically. There are more differences within a ďraceĒ than between ďracesĒ.

8/10th diversity = differences between people
of the same country.
1/10th diversity = differences between nations.
1/10th diversity = differences between ďracesĒ.

So all you ignorant bigots can really just go fuck yourself unless of course you have some better data. (going to love to see this)


If you want the best data available then go read Rathus' Psychology book: Concepts & Connections Ninth & Tenth editions. They're standard books in college and delve quite deeply into the differences between races and unfortunately for negros, it doesn't look too good for them but it's not racist it's just the truth of what is. It's evident that negros will never be able to fit into America and anyone that says otherwise is a delusional liberal.
Achievements
Go to the top of the page
 
+Quote Post
psychÝ
post Mar 24 2008, 03:28 AM
Post #33


Upstanding Citizen


Group: Members
Posts: 0
Joined: 26-August 04
From: The Steel City, England
Member No.: 1,279



QUOTE(Mister Triangle @ Mar 24 2008, 02:52 AM) [snapback]1401297[/snapback]
QUOTE(psychÝ @ Mar 23 2008, 01:19 PM) [snapback]1401173[/snapback]
All humans are very similar genetically. There are more differences within a “race” than between “races”.

8/10th diversity = differences between people
of the same country.
1/10th diversity = differences between nations.
1/10th diversity = differences between “races”.

So all you ignorant bigots can really just go fuck yourself unless of course you have some better data. (going to love to see this)


If you want the best data available then go read Rathus' Psychology book: Concepts & Connections Ninth & Tenth editions. They're standard books in college and delve quite deeply into the differences between races and unfortunately for negros, it doesn't look too good for them but it's not racist it's just the truth of what is. It's evident that negros will never be able to fit into America and anyone that says otherwise is a delusional liberal.

Yeah, i'm doing a degree in genetics so I know you are talking BS because those are the facts.

What a bigot.

Even more entertaining why would they be using a psychology book on a genetics course, I mean damn moron, there are specialist books for genetics and population genetics, why would we read a psychology book, let alone 2 which will be very much the same apart from the 9th edition being less up to date.

Edit: Anyway just for kicks to see the hilarity of your data, give me a reference including page number and subtitle just so I can laugh at your statement, considering I now have a copy of the book in front of me.

This post has been edited by psychÝ: Mar 24 2008, 03:35 AM


--------------------

Dragonfly
Achievements
Go to the top of the page
 
+Quote Post
Samurai_tbag
post Mar 25 2008, 11:21 AM
Post #34


Upstanding Citizen


Group: Members
Posts: 0
Joined: 12-November 04
From: Brighton, UK
Member No.: 5,211



QUOTE(psychÝ @ Mar 24 2008, 03:28 AM) [snapback]1401307[/snapback]
Edit: Anyway just for kicks to see the hilarity of your data, give me a reference including page number and subtitle just so I can laugh at your statement, considering I now have a copy of the book in front of me.

Looks like he got done, haha.


--------------------
Achievements
Go to the top of the page
 
+Quote Post
Mister Triangle
post Mar 25 2008, 08:34 PM
Post #35


Upstanding Citizen


Group: Members
Posts: 0
Joined: 29-December 07
From: West Virginia
Member No.: 38,169



QUOTE(psychÝ @ Mar 23 2008, 11:28 PM) [snapback]1401307[/snapback]
All humans are very similar genetically. There are more differences within a ďraceĒ than between ďracesĒ.

8/10th diversity = differences between people
of the same country.
1/10th diversity = differences between nations.
1/10th diversity = differences between ďracesĒ.

So all you ignorant bigots can really just go fuck yourself unless of course you have some better data. (going to love to see this)

Yeah, i'm doing a degree in genetics so I know you are talking BS because those are the facts.

What a bigot.

Even more entertaining why would they be using a psychology book on a genetics course, I mean damn moron, there are specialist books for genetics and population genetics, why would we read a psychology book, let alone 2 which will be very much the same apart from the 9th edition being less up to date.

Edit: Anyway just for kicks to see the hilarity of your data, give me a reference including page number and subtitle just so I can laugh at your statement, considering I now have a copy of the book in front of me.


ACTUALLY, The genetic differences between whites & blacks are
Here. Laugh at this lil' puddin'.
HEREDITY: The transmission of traits from parent to offspring by means of genes
GENETICS: The area of biology that focuses on biology.
BEHAVIORAL GENETICS: The area of biology & psychology that focuses on the transmission of traits that give rise to behavior. Behavioral genetics also addresses individial differences in behavior.

IF you were studying genetics then you would know that there are differences between races. AWw! I bet you use the UK liberal fantasy nimrod version 3.1-4! If you have the book: Psychology: Concepts & Connections Ninth Edition there genius then I SUGGEST THAT YOU READ ALL OF CHAPTER 9: Start with chapter 2: Biology & Psychology page 47: Genetics & Behavioral Genetics-- & get ready to get your ass schooled, son.

Here's an excerpt from Genetic Influences On Intelligence:
"In other words, variations(the technical term is variance) in IQ scores CAN BE ACCOUNTED FOR BY HEREDITY. It means, rather, that about half of the difference between your IQ score and the IQ scores of other races CAN BE EXPLAINED IN TERMS OF GENETIC FACTORS".

"Psychologist can point with pride to a rich mine of contemporary research on the roles of nature(GENETIC INFLUENCES) --in the developement of intelligence". "It is also true that african-Americans IQ scores are considerably lower than whites according to The BELL CURVE STUDY". Intelligence IS contributed to genetics. Read THE BELL CURVE STUDY.

This post has been edited by Mister Triangle: Mar 26 2008, 02:02 AM
Achievements
Go to the top of the page
 
+Quote Post
Guest_Thrilla in Manila_*
post Mar 25 2008, 08:59 PM
Post #36





Guests






only way to get media coverage is if they didn't get punished for it, if they got over-sentenced the whole country would be on their side

when shit like this happens there is no way white people can win... I'm not white either I'm just saying alot of white people are scary asses that don't speak up when they need to

also, fuck up triangle

obama isn't even black you dumbass

This post has been edited by Thrilla in Manila: Mar 25 2008, 09:00 PM
Achievements
Go to the top of the page
 
+Quote Post
Mister Triangle
post Mar 25 2008, 10:15 PM
Post #37


Upstanding Citizen


Group: Members
Posts: 0
Joined: 29-December 07
From: West Virginia
Member No.: 38,169



He's half, dumbboy and he's a covert mo-slum at that. And no whites from the country are scared of any minority, it's the other way around. Remember what happened the last time that the black panthers tried to march through texas last year? They left in a big hurry! Running like little sissies. You can watch it on youtube. They know better.

In Abraham Lincoln's Emancipation Proclamation of Sept. 1862 he said:

"I have urged the colonization of the Negroes, (back to Africa), and I shall continue. My Emancipation Proclamation was linked with this plan (of colonization).

There is no room for two distinct races of White men in America, much less for two distinct races of Whites and Blacks.

. . . I can think of no greater calamity than the assimilation of the negro into our social and political life as our equal . . .

Within twenty years we can peacefully colonize the Negro . . . under conditions in which he can rise to the full measure of manhood. This he can never do here. We can never attain the ideal union our fathers dreamed, with millions of an alien, inferior race among us, whose assimilation is neither possible nor desirable."

Lincoln actually proposed an amendment to the constitution that would've authorized congress to recolonize all freed Blacks back to Africa. On Aug. 15, l962, Congress did appropriate over half a million dollars for that purpose. Thousands of Negroes had been shipped back when Lincoln was shot.

This post has been edited by Mister Triangle: Mar 25 2008, 10:18 PM
Achievements
Go to the top of the page
 
+Quote Post
Samurai_tbag
post Mar 25 2008, 10:23 PM
Post #38


Upstanding Citizen


Group: Members
Posts: 0
Joined: 12-November 04
From: Brighton, UK
Member No.: 5,211



QUOTE(Mister Triangle @ Mar 25 2008, 10:15 PM) [snapback]1401425[/snapback]
There is no room for two distinct races of White men in America, much less for two distinct races of Whites and Blacks.



Here's where your 'facts' are wrong.


Hispanics: 12.5%

Blacks: 12.4%


The two biggest groups are White and Hispanic.

Source.


--------------------
Achievements
Go to the top of the page
 
+Quote Post
psychÝ
post Mar 25 2008, 11:45 PM
Post #39


Upstanding Citizen


Group: Members
Posts: 0
Joined: 26-August 04
From: The Steel City, England
Member No.: 1,279



QUOTE

ACTUALLY, The genetic differences between whites & blacks are
Here. Laugh at this lil' puddin'.
HEREDITY: The transmission of traits from parent to offspring by means of genes
GENETICS: The area of biology that focuses on biology.
BEHAVIORAL GENETICS: The area of biology & psychology that focuses on the transmission of traits that give rise to behavior. Behavioral genetics also addresses individial differences in behavior.
...

The area of biology that focuses on biology...............................that is what you said, seriously where do I start? Do I start? Can I really be bothered to start?

Let sum it up with just really simple points, cause it is quite clear you didn't copy and paste that from anywhere and actually think you know something about the subject, oh dear.

1) Heredity is genetics, it is the whole point in studying genetics, do you really think anyone cares that gene on the P arm of the Y chromosome the allele coding for an androgen receptors polynucleotide sequence is ATGCAGCTATCGGCCTATAG, no, no one really gives a fuck they care what that code does and why it does it.

2) Your definition of genetics is just a joke, it is the study of DNA and the genome, the affects this has on the phenotype of an organism and how this is information is passed to the next generation and the mechanism of doing this.

3) Psychology is not genetics in anyway, Psychology would be defined as a phenotypic characteristic in genetics.

QUOTE

IF you were studying genetics then you would know that there are differences between races.
I never said there weren't, I purely said it is a completely irrelevant difference unless we are talking about your chances of getting skin cancer or needing vitamin D supplements.
QUOTE

SUGGEST THAT YOU READ ALL OF CHAPTER 9: Start with chapter 2: Biology & Psychology page 47: Genetics & Behavioral Genetics-- & get ready to get your ass schooled, son.
And what is that supposed to prove exactly?

QUOTE

Here's an excerpt from Genetic Influences On Intelligence:
"In other words, variations(the technical term is variance) in IQ scores CAN BE ACCOUNTED FOR BY HEREDITY. It means, rather, that about half of the difference between your IQ score and the IQ scores of other races CAN BE EXPLAINED IN TERMS OF GENETIC FACTORS".
Apart from the fact that IQ is a very poor way to judge intelligence mainly based on these reasons:
    - Standardisation of the test towards white middle class America (A very prominent point)
    - Discrimination
    - Socio-economic status
    - Language
    - Motivation
What you are proposing is that a group of kids from a poorly funded school, with parents on minimum wage meaning they may not have enough food and nourishment or school books, who have to walk rather than get the bus, in an underfunded school, which has worse equipment, doing a test where the question might not make sense to them, (anyone done one of those shitty IQ test that asks you how many nickels and dimes you need to make $5, how the fuck am I supposed to know how much a nickel or dime is worth use really numbers for coins you morons) should on average do as well as a group of middle class American white kids who got drove to school in there Range Rover Sport, after there daddy brought them a new computer to use the CD the school provided for them so they can interactive homework lesson.

Yeah good one.

QUOTE

"Psychologist can point with pride to a rich mine of contemporary research on the roles of nature(GENETIC INFLUENCES)
Oh dear, I mean really clearly you are just an idiot trying to pretend to be clever, the role of nature doesn't mean genetic, it has many connotation.
QUOTE
"It is also true that african-Americans IQ scores are considerably lower than whites according to The BELL CURVE STUDY".

Oh god don't get be started on that book, lets take a group of african immigrants and then compare there data to a group of middle class Americans which the test was standardised for them to understand. The black kids actually did surprising well in that study considering there social background.

QUOTE
Intelligence IS contributed to genetics.
Cool so if I get more intelligent my DNA base pairing changes, remember that kids. Moron.

QUOTE
Read THE BELL CURVE STUDY.
Yeah, I already know about it, it's a bunch of BS science with incorrect assumptions based on purposely bad data, Garbage in = Garbage out

QUOTE
He's half, dumbboy and he's a covert mo-slum at that. And no whites from the country are scared of any minority, it's the other way around. Remember what happened the last time that the black panthers tried to march through texas last year? They left in a big hurry! Running like little sissies. You can watch it on youtube. They know better.
In Abraham Lincoln's Emancipation Proclamation of Sept. 1862 he said:
"I have urged the colonization of the Negroes, (back to Africa), and I shall continue. My Emancipation Proclamation was linked with this plan (of colonization).
There is no room for two distinct races of White men in America, much less for two distinct races of Whites and Blacks.
. . . I can think of no greater calamity than the assimilation of the negro into our social and political life as our equal . . .
Within twenty years we can peacefully colonize the Negro . . . under conditions in which he can rise to the full measure of manhood. This he can never do here. We can never attain the ideal union our fathers dreamed, with millions of an alien, inferior race among us, whose assimilation is neither possible nor desirable."
Lincoln actually proposed an amendment to the constitution that would've authorized congress to recolonize all freed Blacks back to Africa. On Aug. 15, l962, Congress did appropriate over half a million dollars for that purpose. Thousands of Negroes had been shipped back when Lincoln was shot.


BLAH BLAH BLAH, do I look like I give a shit about some bigot from history, nay.


Now with your vast exorbitant knowledge in genetic and momentous research papers and sources go find me one gene inexplicably linked to intelligence that will decrease it or increase it in the general population oh and then don't forget to link it to race, so you better make that a intelligence and skin colour gene.

Oh and don't post in this topic again if you can't.


This post has been edited by psychÝ: Mar 26 2008, 03:03 AM


--------------------

Dragonfly
Achievements
Go to the top of the page
 
+Quote Post
Mister Triangle
post Mar 26 2008, 02:25 AM
Post #40


Upstanding Citizen


Group: Members
Posts: 0
Joined: 29-December 07
From: West Virginia
Member No.: 38,169



All that shit that your mommy just typed; BULLSHIT! Inacurate. Biased as hell. Absolute & complete utter NONSENSE!

Yeah. All the data about the intelligence of the african-American is racist & wrong. Yeah. Sounds just like a buncha liberal shit to me. "If you can't agree with me then don't post again" or "white middle-class america is responsible for how dumb blacks are"...No, liberal. You are wrong and you'll never shut me up and you're in my thread nancy so get the fuck out nigger lover unless you have data from credible UNBIASED sources like I do like THE BELL CURVE STUDY OR THE U.S. DEPT. OF JUSTICE CRIME STATISTICS OR THE FBI CRIME REPORTS! Aww. They're all wrong too. I forgot.

"Apart from the fact that IQ is a very poor way to judge intelligence mainly based on these reasons:
- Standardisation of the test towards white middle class America (A very prominent point)
- Discrimination
- Socio-economic status
- Language
- Motivation"

Yeah. MmmHmmm. rolleyes.gif That and the fact that you can't fix stupid nor change genetics or can you try some liberal tactic of blaming it on some bogus factor. Stupid IS stupid does. Didn't you watch Forest Gump? Damn! Bubba was so damn stupid that he thought chicken was shrimp.

Quit having your mommy come down in the basement and type shit for ya. She don't know what the hell she's talkin' 'bout. You sir, are a fool. And tell uncle tyrone to quit eatin' all the chicken.
Achievements
Go to the top of the page
 
+Quote Post

3 Pages V  < 1 2 3 >
Reply to this topicStart new topic
1 User(s) are reading this topic (1 Guests and 0 Anonymous Users)
0 Members:

 



Lo-Fi Version Time is now: 24th October 2014 - 03:04 PM

GTA 5 | GTA San Andreas | Red Dead Redemption | GTA 4